Question: "When I download human chr22 from your web site, the This is suggested by the following on the general downloads FAQ page at. It would appear that the number of Ns corresponds to the number (perhaps an estimate) of bases the identity of which are not known.
Repeats are masked by capital Ns non-repeating sequence is shown in Hg38.fa.masked.gz - "Hard-masked" assembly sequence in one file. Of 12 or less) are shown in lower case non-repeating sequence is Repeats from RepeatMasker and Tandem Repeats Finder (with period Hg38.fa.gz - "Soft-masked" assembly sequence in one file. Repeats from RepeatMasker and Tandem Repeatsįinder (with period of 12 or less) are shown in lower case non-repeating Hg38.2bit - contains the complete human/hg38 genome sequence I don't know which files you downloaded, but I quote three of the descriptions: The FTP download files are documented on the UCSC site (from which they also may be downloaded from a web browser). What are the repeating N characters denoting?.What is the difference between upper and lower case in nucleotide fasta sequences?.
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNĬtaaccctaaccctaaccctaaccctaaccctaaccctCTGaaagtggacĬtatcagcaggatgtgggtgggagcagattagagaataaaagcagactgc Second strange thing is to see it beginning with sequence like NNNN. TAcactttgggagaccgaggcaggcagatcacgaggtcaggagatcgagaĬcatggtgaaaccccgcctctactaaaaatacaaaaaaattagcctggca TaaataaataaataaataaaAAAGAAAAAGGTTAATACAACATTAAAGAAĬAAGAATTAATATAGCtttttttttttttttttttttttgagacctagtc Here is an example from the file I just downloaded: gagaatcccttgaacccgggaggcggagcttgctgtgagccgagatcgcaĬcactgcactccagcctgggtgacagagccagactccgtctcaaaataaa Does it show the coding and non-coding region? Some part is in small alphabets and some is in large alphabets. I have downloaded human chromosome's data from UCSC FTP.
0 kommentar(er)
